Expression of Zinc finger protein ZAT12 from Arabidopsis thaliana in Escherichia coli
ISSN 2588-1299
VJAS 2019; 3(1): 504-511
Vietnam Journal
of Agricultural
Sciences
Expression of Zinc Finger Protein Zat12
from Arabidopsis thaliana in Escherichia coli
Le Thi Tuyet Cham, Vu Ngoc Thang, Tran Anh Tuan & Vu Thi
Thuy Hang
Faculty of Agronomy, Vietnam National University of Agriculture, Hanoi 131000, Vietnam
Abstract
The C2H2 zinc finger protein ZAT12 has been classified as a plant
core abiotic stress response gene in the early response to multiple
stresses. ZAT12 links the iron deficiency and oxidative stress
responses through the direct interaction with/and negative regulation
of a central regulator - FIT. For further research on the regulation of
the ZAT12 protein in planta, a huge quantity of ZAT12 proteins is
required to inject into mice for the generation of ZAT12 antiserum.
In this study, the gene encoding the ZAT12 protein from Arabidopsis
thaliana was cloned into the expression vector - pETBlue-2 and then
overexpressed in E. coli T7. A high expression level was indicated
by SDS-PAGE. Immunoblot demonstrated successful expression
using a bacterial expression system.
Keywords
ZAT12, zinc finger protein, ZAT12 expression
Introduction
The zinc finger of Arabidopsis thaliana 12 (ZAT12), a member
of the C2H2-type plant-specific zinc (Zn) finger transcription factor
family (Englbrecht et al., 2004; Ciftci-Yilmaz and Mittler, 2008;
Miller et al., 2008; Kiełbowicz-Matuk, 2012), contains an EAR motif
and is thought to function as a repressor of gene expression (Kagale
et al., 2010). ZAT12 was identified among genes induced by light
(Iida et al., 2000; Davletova et al., 2005b), low temperatures (Fowler
& Thomashow, 2002; Kreps et al., 2002; Vogel et al., 2005),
wounding (Cheong et al., 2002), osmotic and salinity stress (Kreps et
al., 2002), and oxidative stress (Rizhsky et al., 2004; Davletova et
al., 2005b; Vanderauwera et al., 2005). ZAT12 is also the direct
target of many transcriptional regulators such as EIN3, bZIP29,
AtUSB1, DRM2, At3g03170, and LEA18 (Peng et al., 2014; Ben
Daniel et al., 2016). However, the role of the ZAT12 protein in the
abiotic stress signaling network has not been fully elucidated.
Received: October 26, 2019
Accepted: June 1, 2020
Recently, ZAT12 was identified in an attempt to find a link
between iron deficiency responses and oxidative stress. In conditions
Correspondence to
504
Le Thi Tuyet Cham et al. (2019)
where iron is poorly available, plants are able to
induce a set of genes that enhance the efficiency
of its uptake by the roots. A central regulator of
this response in the model plant Arabidopsis
(Arabidopsis thaliana) is the basic helix-loop-
helix transcription factor FIT whose activity is
tightly regulated. Using a yeast two-hybrid assay
and BiFC, the EAR motif was demonstrated to
be necessary for the interaction between FIT and
ZAT12 (Le et al., 2016). The expression of the
FIT gene was upregulated in zat12 loss-of-
function plants. In addition, these plants
accumulated a higher amount of iron compared
to the wild type. ZAT12-GFP fluorescence was
detected in Arabidopsis roots, where it could be
observed in the nuclei. This protein was elevated
upon iron deficiency, H2O2, and MG132
treatments. ZAT12 is considered as a link
between iron deficiency and oxidative stress
responses through direct interaction with and
negative regulation of FIT. These functions of
the ZAT12 protein were only demonstrated using
a ZAT12-GFP protein with a GFP antibody in
immunoblot experiments (Le et al., 2016). To
verify this native ZAT12 function, i.e to monitor
Fe dependent expression and the regulation of
ZAT12 protein in planta, it is necessary to
generate an anti ZAT12 antibody. To do this, we
have conducted a series of experiments including
the cloning, transformation, heterologous
expression, and purification of the recombinant
protein. In this study, the ZAT12 recombinant
protein was successfully expressed in E. coli.
expression systems from Novagen were used for
the expression of the ZAT12 protein. Other
standard microbial and recombinant techniques
used throughout this work were as described by
Sambrook et al. (2001).
Generation of the ZAT12-His gene
constructs using PCR
The coding sequence of ZAT12 from
Arabidopsis thaliana was amplified by PCR
using the primer combination 5’ ZAT12_PET
(5’-ATGGTTGCGATATCGGAGATCAA – 3’)
(Figure 2) and ZAT12_CT His 3’ (5’-
TCAAGAGGCCATACCGTGATGATGATGA
TGATGAGAACCACGATAAACTGTTCT
TCCAAGCTCCA -3’) (Le et al., 2016). After
checking the size of these fragments by agarose
electrophoresis, the ZAT12-His fragments were
purified and cloned into the EcoRV cloning site
of the pETBlue-2 vector using the Perfectly
Blunt® Cloning Kit.
Transformation
The recombinant plasmid was transformed into
NovaBlue Singles™ Competent Cells (Novagen,
USA). Identification of successful cloning events
was performed by blue/white screening. The
insertion of ZAT12-His into the pETBlue-2
vector leads to the disruption of the expression of
the lacZ α-peptide, and thereby produces white
colonies on plates supplemented with X-gal and
IPTG (Isopropyl-β-D_thiogalactoside from
Roth, Karlsruhe, Germany). Inversely, colonies
containing the vector without insertion turn blue.
After the initial selection of positive colonies,
colony PCR and sequencing were performed for
verification of positive recombinant plasmids.
After that, the recombinant plasmid was
transformed into Tuner (DE3) pLacI cells and
the recombinant protein induction was
performed according to the manufacturer’s
instructions (Novagen, USA).
Materials and methods
Strains, expression vector, and culture
conditions for cloning
E. coli Nova Blue cells were used as hosts
for transformation. E. coli strains carrying the
pETBlue-2 vector (Figure 1) were grown in
Luria-Bertani medium supplemented with 100μg
of tetracycline/mL when required at 37°C. The
DNA fragments for subcloning were isolated
from agarose gels and cloned into the pETBlue-
2 vector using a Perfectly Blunt® Cloning Kit.
(Novagen, Germany). Tuner (DE3) pLacI E. coli
host strains that are compatible with the pET
Protein electrophoresis and Immuno Blot
Sodium dodecyl sulfate-polyacrylamide gel
electrophoresis (SDS-PAGE) was performed to
determine the molecular mass of the protein
using 10% gels (Laemmli et al., 1970).
505
Expression of Zinc Finger Protein Zat12 from Arabidopsis thaliana in Escherichia coli
Figure 1. Map of the pETBlue-2-vector. Overview of the pETBlue-2-vector map with multiple cloning sites
(Novagen, Gernmany)
5’ ZAT12_PET
770
pETBlue-2 vector
ZAT12 full DNA
pETBlueDOWN
Figure 2. Schematic view of the amplified fragment for cloning and colony PCR. A. The ZAT12 full DNA sequence was
amplified using the 5’ZAT12_PET and ZAT12_CT His 3’ primers. The 6x His Tag was added to the reverse primer. The size
of the amplified fragment indicated the length of the ZAT12 full DNA with 6x His sequence. B. The size of the colony PCR
product was amplified using the 5’ ZAT12_PET and pETBlue Down primers (from Novagen) after transformation.
The bacterial extract containing the
recombinant ZAT12 fusion protein was loaded
on a preparatory gel and blotted to a
nitrocellulose membrane. After Ponceau S
staining, the membrane region containing the
ZAT12 antigen was cut off as a strip. The
membrane was blocked for 1 hour at room
temperature with 1% bovine serum albumin
(BSA) dissolved in PBS-T and subsequently
probed with crude mouse antiserum at 4°C
overnight. The unbound fraction was collected
into a new tube. The membrane was washed 3
times with PBS-T and the bound antibodies were
eluted two times with elution buffer (0.1 M
glycine-HCl pH 2.7, 0.5 M NaCl). The eluted
antibody fractions were immediately neutralized
by adding 1/10 volume of neutralization buffer
(1 M Tris-HCl pH 8.0, 1.5 M NaCl, 1 mM
EDTA, 0.5% NaN3) and BSA was added at a 1
mg mL-1 final concentration (Novagen,
according to manufacturer’s manual).
For the detection of the ZAT12-His protein,
His antibodies and freshly purified undiluted anti-
ZAT12 mouse antiserum were applied. These
primary antibodies were detected with anti-mouse
IgG conjugated with horseradish peroxidase
(1:8000 dilution, Sigma-Aldrich, USA).
The ZAT12-His protein was detected by
incubation with His rat antibody (1:1000 Roche,
Germany) and a secondary antibody anti-rat IgG
(whole molecule)-horse radish peroxidase
conjugate (1:10000, Sigma-Aldrich, USA).
Detection signals were developed using an
Vietnam Journal of Agricultural Sciences
506
Le Thi Tuyet Cham et al. (2019)
enhanced chemiluminescence detection kit
(Biorad, USA) according to the manufacturer’s
protocol.
presence of the recombinant plasmid. In addition,
sequencing of the selected recombinant plasmid
was performed to confirm the proper orientation
of the insert by ligation (Figure 3).
ZAT12 antibody preparation
Resultant colonies were tested for the presence
of the recombinant plasmid by colony PCR, and
colonies were numbered as 1, 2, 3,…, 10. If the
insert was in the correct orientation, the expected
size of the PCR product for ZAT12 with the primer
combination (ZAT12 5' and pETBlueDOWN, see
Figure 2) was approximately 800bp (538bp of
ZAT12 full plus 232bp from the pET Blue2
vector). Colony no. 8 of ZAT12 gave a PCR
product at the expected size.
Based on the predicted antigenic propensity
scores, a peptide corresponding to the N-terminal
of ZAT12 was chemically synthesized and
conjugated with KLH (Bio Trend) and later
injected into mice to obtain a polyclonal
antiserum (this work was conducted by Prof. U.
Müller,
Zoology
Department,
Saarland
University). In this study, the antiserum was
tested for its specificity by detecting bacteria
positively expressing ZAT12.
Expression of ZAT12 protein
After verifying the sequence, the plasmid was
transformed into BL21 (DE3) cells of E. coli for
expression. SDS-PAGE analysis detected the
expected products from BL21 (DE3) cells induced
with IPTG. The results are shown in Figure 4.
Results
Plasmid construction and confirmation of
cloned recombinant ZAT12 plasmid
To generate the recombinant plasmid, the
full-length DNA sequence of ZAT12 was
specifically amplified with the ZAT12-PET and
ZAT12-CT-His primers, which produced an
expected band of 538bp. Upon successful
ligation and transformation, the obtained
colonies were numbered and a colony PCR was
performed to check the positive clones for the
After colony PCR confirmation, the selected
recombinant plasmid was transformed into the
Tuner™ DE3 expression cells. Upon successful
expression of the recombinant 18kDa ZAT12-
His fusion protein at a small scale level, a large
scale expression of ZAT12 protein was
performed.
Figure 3. Preparation of the ZAT12 encoding gene. A. The DNA fragment of ZAT12-His using PCR. B. Amino acid changes
at the 5’-ends of ZAT12 introduced via PCR. C. Colony-PCR of ZAT12-His colonies was performed on 10 colonies.
Resultant colonies were numbered as 1, 2, 3,… ,10. Asterisks (*) indicate the ~800bp size ZAT12 fusion DNA band (from
538bp of ZAT12 full plus 232bp from the pET Blue2 vector). The only colony no. 8 gave a PCR product at the expected size,
Figure 1A. M=ladder. Colony no. 8 was a positive colony.
507
Expression of Zinc Finger Protein Zat12 from Arabidopsis thaliana in Escherichia coli
Insoluble
fraction
Soluble
fraction
kDa
*
*
Figure 4. SDS-PAGE analysis of the heterologously expressed recombinant ZAT12 fusion protein in E. coli. ZAT12 fusion
protein expression in Tuner™ DE3 cells accumulated as insoluble proteins (inclusion bodies) and soluble fraction. Asterisks
(*) indicate the position of ~18kDa ZAT12 fusion protein band (from ZAT12 full gene plus 6 His tags).
which two cysteines and two histidines
coordinate with a single zinc atom to form a
finger construct consisting of a short beta-hairpin
and an alpha helix. At5g59820 was identified
among the genes belonging to this family and
named ZINC FINGER OF ARABIDOPSIS
THALIANA12 (ZAT12). Structural analysis of
the ZAT12 protein showed that it constituted of
162 amino acids divided into two C2H2-type
zinc finger domains with a 22-amino acid inter-
finger region, and a LDLSL core sequence of the
EAR motif localized at the C terminus from
amino acid 143 (Meissner & Michael, 1997;
Englbrecht et al., 2004; Kagale et al., 2010). In
plants, the ethylene-responsive element binding
factor associated with the Amphiphilic
Repression (EAR) motif is a transcriptional
regulatory motif found as an active repressor in
members of the ERF, C2H2, and AUX/IAA
families, among others (Kagale et al., 2010).
Specificity test of the ZAT12 protein
The heterologously expressed recombinant
ZAT12 was purified for affinity and injected into
mice. The immunization of mice and collection
of antiserum were kindly performed by Prof. Uli
Müller and Iris Fuchs, Department of Zoology,
Saarland University. The obtained antiserum was
checked for its specificity on E. coli expressing
the ZAT12 fusion protein (Figure 5). We
detected a single band on western blot that
matched to the specifically expressed and desired
ZAT12 protein so that we were able to conclude
that the ZAT12 protein was expressed
successfully in E. coli.
Discussion
The C2H2-type plant-specific zinc finger
transcription factor family was defined by the
presence of a conserved zinc finger domain, in
Vietnam Journal of Agricultural Sciences
508
Le Thi Tuyet Cham et al. (2019)
Figure 5. Specificity of the ZAT12 protein. A. The last lane from the right-hand side was loaded with ZAT12 induced
bacterial culture and probed/incubated with anti-His antibodies (A), and with anti-ZAT12 unpurified antiserum (B). The
triangle ( ) indicates the position of the ~18kDa ZAT12 fusion protein band (from ZAT12 full gene plus 6 His tags).
At5g59820 was identified to be a homolog of the
Indica rice ZOS3-22 (Os03g0820400,
cloning site to identify transformed bacteria that
carry recombinant pETBlue-2 with Zat12
inserted at the desired orientation. Also, the
amplified fragment was approximately 800bp,
consisting of 538bp of ZAT12 full and 272bp
from the pET Blue2 vector. Lane 8 displayed a
band with a size of approximately 800bp (Figure
1C). Furthermore, lanes 1, 2, 3, 4, 5, 6, 7, 9, and
10 were similar in that they showed the absence
of a band with a size smaller than 1kb. The results
suggested that the colony coded 8 (lane 8) may
carry the recombinant pETBlue-2 with Zat12
insert at the desired orientation. This assumption
was tested through isolation of the plasmid from
colony coded 8, which was followed by
sequencing. The results agreed with the gene
map published in the pETBlue-2 Cloning Kits
User Manual. Hence, the results suggested that
Zat12 was inserted into the cloning site of
pETBlue-2 at the desired orientation. The
converted sequence of ZAT12 showed the
ZAT12 sequence-tagged 6x His had a band with
a size of 1kb (refer to Figure 3). The results
further confirmed that these plasmid DNA
samples were pENTR™/D-TOPO® with Zat12
inserted in the cloning site at the desired
orientation. A high expression level of the
ZAT12 protein was indicated by SDS-PAGE and
Immunoblot. Using His antibody and ZAT12
antiserum in Immuno Blot to determine the
LOC_Os03g6057, ZFP37). ZOS3-22 expression
was also up-regulated in seedlings with a H2O2
treatment and in the shoots of plants exposed to
Fe deficiency or combined Fe and P deficiency
(de Abreu Neto & Frei, 2015).
The coding sequence of ZAT12 from
Arabidopsis thaliana was amplified using touch-
down PCR. The annealing temperature of 58ºC
was suitable for amplification of the ZAT12
gene. Determination of the optimum annealing
temperature for PCR is very important because
total genomic DNA extracted from Arabidopsis
thaliana was used as a template for ZAT12
amplified PCR (Rychlik et al., 1990). The
fragment was a band with a size of 538bp, similar
to the expected ZAT12 fragment size suggesting
successful amplification of Zat12 from
Arabidopsis thaliana genomic DNA using
ZAT12_PET and ZAT12_CT His primers at the
annealing temperature of 58°C.
The transformed Nova Blue bacterial cells
were selected using 100 µg mL-1 tetracycline due
to the presence of the tetracycline resistance gene
in pETBlue-2. Colony PCR on the randomly
selected bacterial colonies was conducted using
the primers ZAT12 5' and pETBlue DOWN
which binds to the vector downstream of the
509
Expression of Zinc Finger Protein Zat12 from Arabidopsis thaliana in Escherichia coli
Gamsjaeger R., Liew C. K., Loughlin F. E., Crossley M. &
specificity of ZAT12 showed that ZAT12 was
expressed successfully in E. coli.
Mackay J. P. (2007). Sticky fingers: zinc-fingers as
protein-recognition motifs. Trends in Biochemical.
Sciences. 32(2): 63-70.
Iida A., Kazuoka T., Torikai S., Kikuchi H. & Oeda K.
(2000). A zinc finger protein RHL41 mediates the light
acclimatization response in Arabidopsis. The Plant
Journal. 24(2): 191-203.
Conclusions
Recombinant ZAT12 was expressed
successfully in E.coli. This study helped
accumulate enough ZAT12 recombinant protein
for immunizing/injecting into mice in the
following study of ZAT12 antibody generation.
Kagale S., Links M. G. & Rozwadowski K. (2010).
Genome-wide analysis of ethylene-responsive element
binding factor-associated amphiphilic repression
motif-containing transcriptional regulators in
Arabidopsis. Plant Physiology. 152(3): 1109-1134.
Acknowledgements
Kiełbowicz-Matuk A. (2012). Involvement of plant
C(2)H(2)-type zinc finger transcription factors in stress
responses. Plant Science. 185-186: 78-85.
The author would like to convey his her deep
thanks to the Laboratory of Botany, Faculty of
Biosciences, University, Saarbrueken, Germany
for their kind hospitality and support in
conducting this study. A special thanks to
Professor Dr. Uli Mueller, Department of
Zoology, Saarland University, for his kind help
in producing anti-ZAT12 antiserum.
Kreps J. A., Wu Y., Chang H. S., Zhu T., Wang X. &
Harper J. F. (2002). Transcriptome changes for
Arabidopsis in response to salt, osmotic, and cold
stress. Plant Physiology. 130(4): 2129-2141.
Laemmli U. K. (1970). Cleavage of structural proteins
during assembly of head of bacteriophage T4. Nature.
227: 680-685.
Le C. T. T., Brumbarova T., Ivanov R., Stoof C., Weber E.,
Mohrbacher J., Fink-Straube C. & Bauer P. (2016).
Zinc finger of Arabidopsis thaliana 12 (ZAT12)
interacts with FER-LIKE IRON DEFICIENCY-
INDUCED TRANSCRIPTION FACTOR (FIT)
linking iron deficiency and oxidative stress responses.
Plant Physiology. 170(1): 540-557.
References
Ben Daniel B. H., Cattan E., Wachtel C., Avrahami D.,
Glick Y., Malichy A., Gerber D. & Miller G. (2016).
Plant Identification of novel transcriptional regulators
of Zat12 using comprehensive yeast one-hybrid
screens. Physiologia Plantarum. 157(4): 422-441.
Miller G., Shulaev V. & Mittler R. (2008). Reactive oxygen
signaling and abiotic stress. Physiologia Plantarum.
133(3): 481-489.
Cheong Y. H., Chang H. S., Gupta R., Wang X., Zhu T. &
Luan S. (2002). Transcriptional profiling reveals novel
interactions between wounding, pathogen, abiotic
stress, and hormonal responses in Arabidopsis. Plant
Physiology. 129(2): 661-677.
Meissner R. & Michael A. J. (1997). Isolation and
characterisation of a diverse family of Arabidopsis two
and three-fingered C2H2 zinc finger protein genes and
cDNAs. Plant Molecular Biology. 33(4): 615-624.
Ciftci-Yilmaz S. & Mittler R. (2008). The zinc finger
network of plants. Cellular and Molecular Life
Sciences. 65: 1150-1160.
Mittler R., Kim Y., Song L., Coutu J., Coutu A., Ciftci-
Yilmaz S., Lee H., Stevenson B. & Zhu J. K. (2006).
Gain- and loss-of-function mutations in Zat10 enhance
the tolerance of plants to abiotic stress. FEBS Letters.
580(28-29): 6537-6542.
Davletova S., Schlauch K., Coutu J. & Mittler R. (2005).
The zinc-finger protein Zat12 plays a central role in
reactive oxygen and abiotic stress signaling in
Arabidopsis. Plant Physiology. 139(2): 847-856.
Peng J., Li Z., Wen X., Li W., Shi H., Yang L., Zhu H. &
Guo H. (2014). Salt induced stabilization of
EIN3/EIL1 confers salinity tolerance by deterring
ROS accumulation in Arabidopsis. PLoS Genetics.
10(10): e1004664.
De Abreu Neto J. B. & Frei M. (2015). Microarray meta-
analysis focused on the response of genes
involved in Redox Homeostasis to Diverse Abiotic
stresses in rice. Frontiers in Plant Science. 6: 1260.
Rizhsky L., Davletova S., Liang H. & Mittler R. (2004).
The zinc finger protein Zat12 is required for cytosolic
ascorbate peroxidase 1 expression during oxidative
stress in Arabidopsis. Journal of Biological Chemistry.
279(12): 11736-11743.
Englbrecht C. C., Schoof H. & Böhm S. (2004).
Conservation, diversification and expansion of C2H2
zinc finger proteins in the Arabidopsis thaliana
genome. BMC Genomics. 5(1): 39.
Fowler S. & Thomashow M. F. (2002). Arabidopsis
transcriptome profiling indicates that multiple
regulatory pathways are activated during cold
acclimation in addition to the CBF cold response
pathway. The Plant Cell. 14(8): 1675-1690.
Rychlik W., Spencer W. J. & Rhoads R. E. (1990).
Optimization of the annealing temperature for
amplification in vitro. Nucleic Acids Research. 18(21):
6409-6412.
Vietnam Journal of Agricultural Sciences
510
Le Thi Tuyet Cham et al. (2019)
Sambrook J. & Rusell D. W. (2001). Molecular Cloning: A
laboratory manual. Cold Spring Harbor Laboratory
Press. 1(2-3):1-2344.
Vanderauwera S., Zimmermann P., Rombauts S.,
Vandenabeele S., Langebartels C., Gruissem W., Inzé
D. & Van Breusegem F. (2005). Genome-wide
analysis of hydrogen peroxide-regulated gene
expression in Arabidopsis reveals a high light-induced
transcriptional cluster involved in anthocyanin
biosynthesis. Plant Physiology. 139(2): 806-821.
Vogel J. T., Zarka D. G., Van Buskirk H. A., Fowler S. G.
& Thomashow M. F. (2005). Roles of the CBF2 and
ZAT12 transcription factors in configuring the low
temperature transcriptome of Arabidopsis. The Plant
Journal. 41(2): 195-211.
511
8 trang
13840
Free
Bạn đang xem tài liệu "Expression of Zinc finger protein ZAT12 from Arabidopsis thaliana in Escherichia coli", để tải tài liệu gốc về máy hãy click vào nút Download ở trên
File đính kèm:
- expression_of_zinc_finger_protein_zat12_from_arabidopsis_tha.pdf
