Genotyping method and frequency of single nucleotide polymorphism rs12970134 near melanocortin-4 receptor genotypes in Hanoi preschool chidren population
ISSN: 1859-2171
e-ISSN: 2615-9562
TNU Journal of Science and Technology
225(05): 38 - 44
GENOTYPING METHOD AND FREQUENCY OF SINGLE NUCLEOTIDE
POLYMORPHISM RS12970134 NEAR MELANOCORTIN-4 RECEPTOR
GENOTYPES IN HANOI PRESCHOOL CHIDREN POPULATION
Nguyen Thi Trung Thu, Le Thi Tuyet*
Hanoi National University of Education
ABSTRACT
Melanocortin-4 receptor is part of the central melanocortinergic system and plays critical roles in central
regulation of food intake, energy homeostasis and body weight, so that this gene is related to obesity
and insulin resistance including single nucleotide polymorphism rs12970134. Thus, this study aimed to
find out a protocol for genotyping rs12970134 near Melanocortin-4 receptor by AS-PCR method,
analyzing the genotype and allele ratios of this single nucleotide polymorphism in 200 3-5 years old
children in Hanoi, Vietnam (50% boys). This protocol used the forward primers including 5’-
tcttaccaaacaaagcatgtg-3’ to detect allele G, and 5’-tcttaccaaacaaagcatgta-3’ to detect allele A; and the
reverse primer 5’-gtcattcccactaccacctg-3’. The optimized PCR protocol was that 94oC for 3 min and 34
cycles of denaturation at 94oC for 30 sec, primer annealing at 54oC for 40 sec, primer extension at 72oC
for 30 sec, final extension at 72oC for 8 min, stopped by chilling at 4oC. The 208 bp PCR products were
detected on Redsafe-stained 2.5% agarose gel. The results were verified by using the sequencing
method. In the entire samples, the GG genotype was the largest (57.5%), and the AA genotype was the
lowest (4%). The frequencies of the G and A alleles were 0.77 and 0.23, respectively.
Key words: Melanocortin-4 receptor; single nucleotide polymorphism; rs12970134; AS-PCR
method; preschool children.
Received: 09/02/2020; Revised: 27/4/2020; Published: 28/4/2020
PHƯƠNG PHÁP PHÂN TÍCH KIỂU GEN VÀ TẦN SỐ ALEN CỦA ĐA HÌNH
NUCLEOTIDE ĐƠN RS12970134 GẦN THỤ THỂ MELANOCORTIN-4
Ở TRẺ MẦM NON TẠI HÀ NỘI
Nguyễn Thị Trung Thu, Lê Thị Tuyết*
Trường Đại học Sư phạm Hà Nội
TÓM TẮT
Thụ thể Melanocortin-4 có liên quan đến bệnh béo phì, kháng insulin do đóng vai trò quan trọng
trong việc điều hòa lượng thức ăn ăn vào, cân bằng nội môi và khối lượng cơ thể. Mục tiêu của
nghiên cứu này là xây dựng được phương pháp AS-PCR phân tích kiểu gen của đa hình nucleotide
đơn rs12970134 gần thụ thể Melanocortin-4 và xác định tỉ lệ alen của đa hình nucleotide đơn này
ở trẻ em 3-5 tuổi tại Hà Nội. Nghiên cứu đã thiết kế được các đoạn mồi để xác định alen của đa
hình nucleotide đơn rs12970314 gồm mồi xuôi phát hiện alen G: 5'-tcttaccaaacaaagcatgtg-3', phát
hiện alen A: 5'-tcttaccaaacaaagcatgta-3'; và mồi ngược: 5'-gtcattcccactaccacctg-3'. Chu trình nhiệt
của phản ứng PCR được tối ưu hóa là: 94oC (3 phút) và 34 chu kỳ: biến tính ở 94oC (30 giây), gắn
mồi ở 54oC (40 giây), kéo dài ở 72oC (30 giây), bước kéo dài cuối ở 72oC (8 phút), kết thúc ở 4oC.
Sản phẩm PCR 208 bp được phát hiện trên gel agarose 2,5% nhuộm redsafe. Kiểu gen được kiểm
tra bằng phương pháp giải trình tự gen. Trong toàn bộ mẫu, tỉ lệ kiểu gen GG là lớn nhất (57,5%)
và AA là thấp nhất (4%). Tần số của các alen G và A lần lượt là 0,77 và 0,23.
Từ khóa: Thụ thể Melanocortin-4; đa hình nucleotide đơn; rs12970134; phương pháp AS-PCR;
trẻ mầm non.
Ngày nhận bài: 09/02/2020; Ngày hoàn thiện: 27/4/2020; Ngày đăng: 28/4/2020
38
http://jst.tnu.edu.vn; Email: jst@tnu.edu.vn
Nguyen Thi Trung Thu et al.
TNU Journal of Science and Technology
225(05): 38 - 44
1. Introduction
(Realtime PCR) [5], [8], GeneChip [13].
However, it is difficult to identify the
rs12970134 polymorphism in large-size
samples of Vietnamese population due to the
limitations of access to equipment, costly
chemical and biological expenses. Allele
specific polymerase chain reaction (AS-PCR)
is a PCR-based method which can be
employed to detect the known single
nucleotide polymorphisms (SNPs). The
specific primers are designed to permit
amplification by DNA polymerase only if the
nucleotide at the 3’-end of the primer
perfectly complements the base at the variant
or wild-type sequences. After the PCR and
electrophoresis, the patterns of specific PCR
products allow the differentiations of the SNP
to determine whether the genotype was
homozygous wild type, heterozygous or
homozygous variant [14]. This method is
relatively cheaper than other available
methods. However, in order to create a
working AS-PCR-based genotyping system, it
needs to design primers and well optimized
PCR conditions.
Melanocortin-4 receptor (MC4R) gene is
located on chromosome 18q22 [1]. MC4R, a
G protein-coupled receptor is expressed in the
developing autonomic and central nervous
systems [2]. Activation of melanocortin-4-
receptors (MC4Rs) reduces body fat stores by
decreasing food intake and increasing energy
expenditure [1]. Activation of MC4R proteins
reduces body fat stores by decreasing food
intake and increasing energy expenditure [1].
Mutations in the MC4R leads to a reduced
receptor function found in 2–4% of extremely
obese individuals [3]. Previous studies
demonstrated several MC4R variants and
common genetic polymorphisms near the
MC4R gene contributing to different levels of
obesity [4].
Recent genome wide scans found common
variants near MC4R were related to obesity
and insulin resistance such as rs17782313,
rs17700633,
rs12970134,
rs477181,
rs502933, and rs4450508. Among these
variants, rs12970134 (A/G) located 154 kb
downstream of MC4R has been studied most
often. Many studies reported the association
of rs12970134 MC4R variant with several
obesity-related traits (such as: waist
circumference, BMI) [4], [5], central obesity
[6], [7] and insulin resistance [4], polycystic
ovary syndrome [8], coronary artery disease
[9]. Whereas some studies revealed
nonsignificant association between this
variant and these diseases [10], [11]. This
may be due to differences in study
populations (gender, age, race) [4], [12] and
environmental influence or lifestyle factors
(energy intake and physical activity).
Therefore, identifying the genotypes of this
polymorphism in the Vietnamese population
and further to study the association between
rs12970134 with diseases will be of great
significance to public health care in Vietnam.
Thus, this study aimed to find out a protocol
for genotyping rs12970134 near MC4R by
using AS-PCR and analyze the genotype and
allele ratio of this SNP in Hanoi preschool
chidren population.
2. Research methodology
2.1. Subjects and data collection
In this study, 300 preschool children (36-60
months of age, 150 males and 150 females) in
Hanoi with normal nutritional status,
randomly were selected from the subjects of
project B2018-SPH50 - a cross-sectional
study identifying Kinh ethnic representing the
major ethnic of Vietnam.
Classification of nutrition status of children
was performed according to WHO 2006
criteria; normal nutritional status were
children with Z-score BMI by age and gender
ranged from -2 to 2.
There are several approaches to genotype
rs12970134 near MC4R, including TaqMan™
39
http://jst.tnu.edu.vn; Email: jst@tnu.edu.vn
Nguyen Thi Trung Thu et al.
TNU Journal of Science and Technology
225(05): 38 - 44
The exclusion criteria were children with
acute or chronic diseases such as tuberculosis,
HIV/AIDS.
µL master mix Dream Taq Green (containing:
0.4 mM Dream Taq DNA polymerase, 0.4
mM 2X Dream Taq Green buffer, 0.4 mM
dATP, 0.4 mM dCTP, 0.4 mM dGTP, 0.4
mM dTTP and 4 mM MgCl2), 0.35 µL for
each primer (concentration 10 pmol), 1.5 µL
of DNA sample (concentration 37-60 ng/µl)
in a total volume of 5.5 µL.
Samples of cheek mucosa cells were taken
with the consent of parents or official
guardians. The project was approved by the
Medical Ethics Council of the Institute of
Nutrition with Decision No. 343/VDD-QLKH
on July 27, 2018.
The gradient PCR method was used to
determine the annealing temperature. The
PCR conditions were as follows: 3 min at
94oC, 34 cycles of 30 sec at 940C, 30 sec at
52oC/54oC/56oC, 30 sec at 72oC, final
extension 8 min at 72oC, chilling at 4oC. PCR
products (208-bp band) were detected on the
redsafe-stained 2.5% agarose gel by the
electrophoresis in 0.5X TBE buffer. The
DNA band was taken by using Geldoc-ItTM
gel camera. The optimal protocol was
recruited from the results of trials.
2.2. DNA extraction method
DNA was extracted from the sample of the
cheek mucosa cell by using the GeneJET
Genomic DNA Purification kit (Thermo,
USA) according to the manufacturer's
instructions.
2.3. Genotyping method
Protocol of genotyping SNP rs1137101 by AS-
PCR method included the following steps:
2.3.1. Design primers
2.4. Statistical analysis
Nucleotide sequence of DNA fragments
containing SNP rs12970134 on NCBI
database [15] was used to design three of
PCR primers (including wildtype and mutant
primers to detect 2 alleles (G or A) and one
common primer. Designing wildtype and
mutant primers to identify G or A allele of
rs12970134 near MC4R gene was based on
Wangkuhang et al. [16]. Next, last primer was
designed by using Oligo 7 Primer Analysis
Software [17] and UCSC In-Silico PCR
online [18] to choose pairs of primers that
have homologous melting temperature (Tm)
and don’t match each other. The melting
temperature of the primers was approximately
54°C according to recommendations of the
above software.
Genotype and allele frequencies are expressed
in %. Add the Hardy-Weinberg equation to
identify allele frequencies.
3. Results and discussion
3.1. Optimize the protocol of genotyping
MC4R rs12970134
3.1.1. Design the primers
The results showed 5 oligos used to perform
the AS-PCR. But all products were so short,
that we only chose wildtype and mutant
forward primers. The sequences of wildtype
and
forward
primers
were
5’-
TCTTACCAAACAAAGCATGTG-3’, and
5’-TCTTACCAAACAAAGCATGTA-3’.
The sequence of common reverse primer was
5’- GTCATTCCCACTACCACCTG-3’. The
theorical PCR product was a 208-bp in length:
2.3.2. Optimal protocol design for polymerase
chain reaction
TCTTACCAAACAAAGCATGT(G/A)caaac
aaagatttatcagaagggtgcttgttagtacctgtattcaaaggg
agaactagtcaaacctcaaaggggcaaggccaaccaggacc
aacctagcagggcaagcatgtctccacactgcctatcttcagat
gagcatttttttcctttaggcaagtttttcCAGGTGGTAG
TGGGAATGAC
To genotype rs12970134 polymorphism using
AS-PCR, each genotype was determined by
two independent reactions of A and G alleles.
The composition of each PCR reaction
consists of 0.8 µL of nuclease-free water, 2.5
40
Nguyen Thi Trung Thu et al.
TNU Journal of Science and Technology
225(05): 38 - 44
3.1.2. Determination of the annealing temperature of the gradient PCR
Figure 1. Electrophoresis image of gradient PCR products
Ta: Temperature of annealing, (-): negative control, M: CSL-MDNA-100bp DNA Ladder RTU
Genotype: 1 (GG), 2 (AG), 3 (AA)
Figure 1 showed that at Ta = 54oC, the amplified band was the thickest and easy to determine G
and A alleles. Thus, the optimized PCR protocol was 94oC for 3 min and 34 cycles of
denaturation at 94oC for 30 sec, primer annealing at 54oC for 40 sec, primer extension at 72oC for
30 sec, final extension at 72oC for 8 min, stopped by chilling at 4oC.
3.2. Result of validation
To validate AS-PCR method, two products of A allele from sample 2 and G allele from sample 1
were verified by sequencing with reverse primer: 5’- GTCATTCCCACTACCACCTG-3’ (Figure
2). The obtained sequences from sequencing are single strands and complementary to the single
PCR product sequence above (3.1.1).
Genotypes were analyzed by
AS-PCR method
Allele A
Result of sequencing method
(sample 2)
Allele G (Sample 1)
Figure 2. Allele A and G products were validated by sequencing method
Thus, the genotypes identified by using AS-PCR method were completed in concordance with
those of the sequencing method. Consequently, we used the optimized AS-PCR protocol to
genotype 200 samples and the results are presented in Figure 3.
41
http://jst.tnu.edu.vn; Email: jst@tnu.edu.vn
Nguyen Thi Trung Thu et al.
TNU Journal of Science and Technology
225(05): 38 - 44
Figure 3. Electrophoresis image of AS-PCR products with some samples
(-) : negative control, M: CSL-MDNA-100bp DNA Ladder RTU
Genotype: 1 (GG), 2 (AG), 3 (AA), 4 (AG), 5 (GG), 6 (AG), 7 (GG), 8 (GG), 9 (GG), 10 (GG), 11 (GG),
12 (GG), 13 (GG), 14 (GG), 15 (GG), 16 (GG), 17 (AG), 18 (GG).
3.3. Frequencies of MC4R rs12970134
polymorphism in Hanoi preschool children
genotypes in samples of preschool children in
Hanoi were in the Hardy – Weinberg
distribution (P = 0.265).
Children were chosen equally by gender (50%
boy) and age group (3-5 years: 25% (3–3.5
years), 25% (3.5–4 years), 25% (4–4.5 years),
25% (4.5–5 years)). The anthropometric
indicators of 200 normal children (WHO
2006 criteria) were represented in our current
publication [19].
The frequencies of rs12970134 genotypes in
different populations varied significantly
around the world [20]. The heterogeneity of
the proportions of alleles in different
populations was influenced by ethnic
characteristics. According to Marth (2004),
the history and characteristics of nation
formation have a great influence on its
biological characteristics, anthropology, and
genetic background [21]. In the Hanoi
primary school children population, the
frequency of minor A allele was 0.23. This
result was the same with other populations
[20]. The ratio of genotypes in our study is
almost equal to the frequencies in the
Japanese in Tokyo, Japan (JPT) [20].
The frequencies of genotypes and alleles of
MC4R rs12970134 polymorphism among
these children is shown in Table 1.
Table 1. Genotype and allele frequencies of
MC4R rs12970134 polymorphism in Hanoi 3-5
years old children
MC4R rs12970134
Number
(Frequencies)
115 (57.5%)
77 (38.5%)
8 (4.0%)
GG
Genotype
AG
AA
G
The limitation of this study is that the
genotyping method identifies only one SNP
genotype for one procedure. Also in this
study, the frequencies of alleles and
genotypes were determined only in children
with normal physical development in Hanoi,
and not the entire population of Vietnam.
Further research is required large samples that
are representative of the entire population, and
the inclusion of children with nutritional
disorders, children from different ethnic groups.
307 (77%)
93 (23%)
Allele
A
P HWE
0.265
The data in the table are presented by n (%),
HWE: Hardy-Weinberg equation, P value were
from test 2 or Fisher exact.
In the entire samples, the GG genotype was
the highest (57.5%), and the AA genotype
was the lowest (4%). The frequencies of the
G and A alleles were 0.77 and 0.23,
respectively. The frequencies of rs12970134
42
Nguyen Thi Trung Thu et al.
TNU Journal of Science and Technology
225(05): 38 - 44
circumference and insulin resistance," Nature
genetics, vol. 40, no. 6, p. 716, 2008.
4. Conclusions
This research shows the AS-PCR method for
genotyping MC4R rs12970134 polymorphism
in Vietnam’s laboratories. This protocol used
[5]. D. Albuquerque, C. Nóbrega, R. Rodríguez-
López, and L. Manco, "Association study of
common polymorphisms in MSRA, TFAP2B,
MC4R, NRXN3, PPARGC1A, T MEM18,
SEC16B, HOXB5 and OLFM4 genes with
obesity-related traits among Portuguese
children," Journal of human genetics, vol. 59,
no. 6, p. 307, 2014.
the
forward
primers
(5’-
tcttaccaaacaaagcatgtg-3’ to detect allele G,
and 5’-tcttaccaaacaaagcatgta-3’ to detect
allele A), and the reverse primer (5’-
gtcattcccactaccacctg-3’). The temperature to
anneal primer was 540C.
[6]. L. F. Been et al., "Replication of association
between
melanocortin‐4
a
common
receptor
variant
gene
near
and
Among children aged 3-5 years in Hanoi, the
frequency of GG genotype was the highest
(57.5%) and the frequency of AA genotype
was the smallest (4%). The method for
identifying genotypes in this study was
developed and optimized to ensure data
accuracy, reduce costs, and can be used in
many molecular biology laboratories to
identify the MC4R rs12970134 genotype with
large sample sizes.
obesity‐related traits in Asian Sikhs," Obesity,
vol. 18, no. 2, pp. 425-429, 2010.
[7]. O. P. Dwivedi et al., "Strong influence of
variants near MC4R on adiposity in children
and adults: a cross-sectional study in Indian
population," Journal of human genetics, vol.
58, no. 1, pp. 27, 2013.
[8]. A. A. Batarfi et al., "MC4R variants
rs12970134 and rs17782313 are associated
with obese polycystic ovary syndrome
patients in the Western region of Saudi
Arabia," BMC medical genetics, vol. 20, no.
1, pp. 144, 2019.
[9]. H. Huang et al., "Implication of genetic
variants near TMEM18, BCDIN3D/FAIM2,
and MC4R with coronary artery disease and
obesity in Chinese: a angiography-based
study," Molecular biology reports, vol. 39,
no. 2, pp. 1739-1744, 2012.
[10]. M. Bazzi et al., "Association between FTO,
MC4R, SLC30A8, and KCNQ1 gene variants
and type 2 diabetes in Saudi population,"
Genet Mol Res, vol. 13, no. 4, pp. 10194-
10203, 2014.
[11]. B. Xi et al., "Association between common
polymorphism near the MC4R gene and
obesity risk: a systematic review and meta-
analysis," PloS one, vol. 7, no. 9, p. e45731,
2012.
[12]. D. P. Zobel et al., "Variants near MC4R are
associated with obesity and influence obesity-
related quantitative traits in a population of
middle-aged people: studies of 14,940
Danes," Diabetes, vol. 58, no. 3, pp. 757-764,
2009.
[13]. R. J. Loos et al., "Common variants near
MC4R are associated with fat mass, weight
and risk of obesity," Nature genetics, vol. 40,
no. 6, p. 768, 2008.
[14]. M. N. Darawi et al., "Allele-specific
polymerase chain reaction for the detection of
Alzheimer’s disease-related single nucleotide
Acknowledgments
The authors would like to thank Laboratory
Center at Institute for Preventive Medicine
and Public Health for kindly helps and
supports. The study was supported by
Ministry of Education and Training, Vietnam,
grant no B2018 - SPH50. The research
protocol was approved by The Ethics
Committee of the National Institute of
Nutrition, Vietnam.
REFERENCES
[1]. N. Balthasar et al., "Divergence of
melanocortin pathways in the control of food
intake and energy expenditure," Cell, vol.
123, no. 3, pp. 493-505, 2005.
[2]. K. G. Mountjoy and J. M. Wild,
"Melanocortin-4 receptor mRNA expression
in the developing autonomic and central
nervous systems," Developmental brain
research, vol. 107, no. 2, pp. 309-314, 1998.
[3]. F. Geller et al., "Melanocortin-4 receptor gene
variant I103 is negatively associated with
obesity," The American Journal of Human
Genetics, vol. 74, no. 3, pp. 572-581, 2004.
[4]. J. C. Chambers et al., "Common genetic
variation near MC4R is associated with waist
43
http://jst.tnu.edu.vn; Email: jst@tnu.edu.vn
Nguyen Thi Trung Thu et al.
TNU Journal of Science and Technology
225(05): 38 - 44
polymorphisms," BMC medical genetics, vol.
14, no. 1, p. 27, 2013.
[15]. National Center for Biotechnology
[19]. D. T. T. Le, T. T. T. Nguyen, N. V. Savvina,
and T. T. Le, "Genotyping method and
frequency of genotypes of single nucleotide
polymorphism of the leptin receptor gene
(LEPR-rs1137101) in preschool children in
Vietnam," (In Russia), Pediatria named after
G.N. Speransky, vol. 99, no. 1, pp. 121-126,
2020.
Information,
"dbSNP
short
genetic
variations", 2019. [Online]. Available:
np_ref.cgi?do_not_redirect&rs=rs12970134.
[Accessed Aug. 11, 2019].
[20]. MediaWiki and National Center for
Biotechnology Information, “SNPedia”, Dec.
[16]. P. Wangkumhang et al., "WASP: a Web-
based Allele-Specific PCR assay designing
tool for detecting SNPs and mutations," BMC
Genomics, vol. 8, no. 1, pp. 275-283, 2007.
[17]. W. Rychlik, Oligo 7. [CD-ROM]. Cascade,
Co: Molecular Biology Insights, 2009.
07,
2019.
[Online].
Available:
134. [Accessed Feb. 7, 2020].
[21]. G. T. Marth, E. Czabarka, J. Murvai, and S.
T. Sherry, "The allele frequency spectrum in
genome-wide human variation data reveals
signals of differential demographic history in
three large world populations," Genetics, vol.
166, no. 1, pp. 351-372, 2004.
[18].
J. Kent, "UCSC In-Silico PCR", 2013.
Available:
[Online].
d=start. [Accessed Aug. 12, 2019].
44
7 trang
14/04/2022
1580
Bạn đang xem tài liệu "Genotyping method and frequency of single nucleotide polymorphism rs12970134 near melanocortin-4 receptor genotypes in Hanoi preschool chidren population", để tải tài liệu gốc về máy hãy click vào nút Download ở trên
File đính kèm:
- genotyping_method_and_frequency_of_single_nucleotide_polymor.pdf
